Life in Navy Boot Camp Essay

It was a warm summer evening as I packed for Navy Boot Camp. I carefully went down the list of things I could take and ensured I didn’t have anything else. A little nervous I went to talk to my parents about my move to becoming my own man. I looked at their faces and could tell that although they were proud they were a little nervous about their only son leaving home for the first time. My mom tried to smile but she was proud yet nervous because I had always been her little guy so she was having a hard time letting go. After a short conversation with my parents I decided to try and rest for the long journey ahead. Its now 5 o’clock in the morning and I’m up to shower and get ready for the trip, I didn’t sleep very much because I was so nervous. I showed and got ready for the trip to the Military Entrance Processing Stations (MEPS) for my final swearing in. My first trip included my initial processing and medical screening and now it was time to put all that into action. As my parent drove me to the station the car was very quiet. As we pulled up my parents got out and hugged me and wish me well. I walked in and looked back at them and it was like the cord was being cut between us, now it was time for me to make them proud and show them what I’d learned from them. The officer swore us in and we all boarded the bus starring out the window like lost kids. Hours later we arrived at Boot Camp in Great Lakes, Michigan. As we pulled up Company Commanders ran out yelling and screaming at us to put all our stuff in one hand and line up on the footprints. My heart was beating super fast and I was like what have I done. We marched into this room where they asked us to take out all our stuff, they went through it and told us what we could keep and what had to be sent home. After feeding us, they took everyone to the barber shop and shaved all our heads. They then issued us our initial uniforms and began indoctrination. After marching back to our dorms, we were told how the bed should be made, stenciled all our gear, showered and went to bed. The first night I can honestly say I missed my folks and at one point wanted to cry but I pushed on. I knew I had to do this for me and them, I had to show myself first and them second that I had what it took to make it. Day two and forward we woke up at 4 am with yelling and screaming that we had 15 minutes to shower, shave and get in line for physical training and breakfast. Everything was 15 to 20 minutes including eating; you learn to eat real quickly. Training was tough but as the weeks went on it got easier. Then around week 4 we had to swim, I was never a strong swimmer so I was nervous but I made it through. Around week five it seemed they got a little easier and then explained that the toughness was to help us rely on each other and build the necessary teamwork within us all. As time went on we had learned the entire Chain of Command, proper Navy rules and how to properly wear all the uniforms and the seasonal changes for whites and blues. As the 8th week came we got ready for graduation. Everyone was ready to show their parents how much they had grown up in the last two months. Part of growing up was proper grooming, making our beds and being responsible and accountable for each other. Some of the guys in my company sat around the night before talking about some of the hard times in boot camp. I talked about the hard part for me was the fire fighting training and taking off that gas mask, my eyes burned so bad and I coughed like I was going to die. We laughed so hard about that and having to jump off that diving board that seems like it was 100 stories tall. So now its graduation day and I’m so excited to see my parents and so they can see how I’ve turned from their little boy to this young man. We march out on the field and the guide yells â€Å"eyes right† and I look over and see my parents. My mom was crying as usual and my dad had the biggest smile on his face, it was a time I will always remember. Their little guy was finally a man.

How Old World Diseases Destroyed Indian America Essay

The Invisible Enemy – How Old World diseases destroyed Indian America and created Colonial America. In the years prior to the Pilgrims establishing Plymouth colony in 1620, the area had been ravaged by an epidemic of disease which had wiped out the original Indian inhabitants. The Pilgrims believed that God had sent the disease among the Indians to clear the site for his ‘chosen people’. This is but one example of how the introduction of disease would forever change the existing Indian America into a ‘new’ America the Natives would barely recognize and would face an everlasting struggle to be part of. The impact of Old World diseases is one of the most critical aspects to understanding the history of Native American Indians. Old World pathogens were carried by the Europeans into the ‘virgin soil’ of Indian America would forever change the very existence of the Native Americans. Epidemics of killer disease were to rampage through Indian society and the Indians being immunologically defenseless succumbed in their thousands. Smallpox was the most devastating of the early killer diseases, followed by deadly strains of typhus and measles (Thornton 1987:44-45). These were followed by bubonic plague, diphtheria, cholera, scarlet fever, typhoid, mumps, pertussis, colds, pleurisy, and, virulent forms of pneumonia and influenza along with respiratory infections, poliomyelitis, venereal syphilis, malaria, yellow fever and dysentery. The mortality rates from smallpox were appallingly high and the periodic outbreaks compounded the losses. Thornton, Miller and Warren (1991:41) conclude that â€Å"American Indian populations were exposed to cycles of population reduction caused by both recurrent epidemics of the same disease and by epidemics of newly encountered diseases experiencing ‘virgin veil’ conditions†. In 1779, smallpox broke out in Mexico City, and over the next four years the disease reached pandemic proportions, spreading in all directions; through the Southwest, the Great Plains, Rocky Mountains and by 1783 into Canada. Thousands of Indians died. Mortality rates of 90 per cent were commonplace; tribes were decimated, in some instances wholly obliterated. Indian populations fell into a precipitous decline; one estimate speculates that the population of Native Indians in North America fell by 74 percent between 1492 and 1800. In some regions populations recovered and in some areas increased, as refugees from other areas coalesced with existing groups, but all told, disease, in conjunction with war, slavery and other cultural disruptions determined there was scant opportunity for population recovery to occur. Treatment of epidemic related illnesses by traditional methods were often lethally counterproductive. Sweat lodge ceremonies to purify the body required convening people in a confined space and therefore making the airborne transmission of viruses easier. The profuse sweating brought about dangerous dehydration as did the use of customary herbal medicines, many of which contained cathartic and emetic properties. With the Indians resorting in anguish to curing societies and community rituals to combat new diseases; shamans explored new and more effective rituals through fasting and dreaming. The Mandan Indians, a farming tribe, living along the Missouri River at the edges of the Great Plains, were virtually wiped out by disease. When first encountered by the French in 1738 the Mandans population was approximately 15,000 but over the next hundred years, numbers declined dramatically. The Mandans location at the hub of the trade network on the Missouri River guaranteed exposure to the epidemic diseases sweeping through trade routes. Nucleated, sedentary tribes were hardest hit by disease; for the Mandans and â€Å"river peoples† like them, this caused further shifting of the power balance in the region to the Plains groups. After experiencing devastating losses in the smallpox pandemic of 1779-81, by June 1837 the Mandan population was at best 2,000; by October 1837, after another smallpox epidemic, 138 Mandan Indians remained. Like the Mandans, the Huron interactions with European traders inevitably brought disease to their villages. Prior to the summer of 1634, a Huron population of 30,000 persons and 20 villages was estimated by the French Jesuits who had lived among them. Influenza struck in 1636. Smallpox hit hard in the mid-1630s, returning in 1639 and by 1640 half the Huron people had been killed by the disease. A house to house census conducted by the Jesuits in the spring of 1639 and over the winter of 1639-40, documents the impact of the 1639-40 smallpox epidemic; the last in a series of catastrophic diseases between 1634 and 1640. A total of 12,000 Huron and their neighbors the Tionantate remained. As disease took its appalling toll, the Huron looked increasingly to the Jesuits for spiritual help. The missionaries who had been barely tolerated before, were largely unaffected by disease and therefore in the eyes of the Huron, men of power. Reinforcing this belief was the failure of the Huron shamans to forewarn or safeguard their people from the devastation. Over the course of the six years between 1634 and 1640, the Huron experienced a depopulation rate of 60 per cent. The Kiowa were a nomadic, buffalo-hunting tribe. They ranged from the head of the Missouri River to the Black Hills until driven southward by the Arapaho, Cheyenne and Sioux to the region near the Arkansas River in the early nineteenth century. At this time the Kiowa numbered around 2,000. Plains Indians being more dispersed, had a lesser chance of infection and greater chance of survival, but in the eighteenth and nineteenth centuries, epidemics of smallpox struck the Indians of the West hard. Up to half of the Plains Indians may have died in the smallpox pandemic of 1779-81, which had advanced along trade routes that the Indians followed to trade horses. The Dohasan calendar (1832-92) was begun by the Kiowa chief named Dohasan and continued until 1892 by his nephew when Dohasan died in 1866, chronicles sixty years of devastating change for the Kiowa. Using a copy of the calendar drawn by Dohasan himself, anthropologist James Mooney compiled an account of the events depicted by the calendar, from information supplied by Dohasan and supplemented with information from other Kiowa chronicles. The calendar accounts epidemics among the Kiowas in the winter of 1839-40 and 1861-62, and in the summer of 1849, cholera. By the summer of 1879, buffalo were so scarce that to keep from starving the Kiowas had to kill and eat their horses. The calendar ends in 1892 with a measles epidemic, which broke out at the reservation school, and once the school superintendent sent the sick children home, spread quickly. In 1848 gold was discovered in California, this inevitably brought more immigrants across the Plains, who in turn brought cholera, measles and scarlet fever to the Indians. The eventual conquest of the West by the American military came about in the in the aftermath of biological catastrophes which had left the Indians practically powerless and unable to resist. Conclude about how these experiences/events were critical in native American history Conclude by explaining why (or why not studying native American history is important today Native American history is important and it is imperative that it still be studied today. As part of the fundamental roots of this country; and the brutal behaviors It is impossible not to be apathetic to the Native Indians immense suffering at the hands of the formation of Colonial America. The gains achieved by the new America’ were at the detriment of the Indian people.

2009 Chrysler Fiat Strategic Alliance

The company had no choice but to look for a partner. During this process, Chrysler explored the possibility of a tie-up with GM, Ford, Volkswagen, Tata Motors, Nissan and Fiat. Eventually Chrysler decided on creating a strategic alliance where Fiat agreed on taking a 20 percent stake in Chrysler. In the next five years, the tie-up may increase Fiat’s ownership of Chrysler to 35 percent. Both companies show compatibility in their product portfolios, global operations, and technology sharing areas. Case ObjectivesThe primary objective of this case is to analyze and discuss Chrysler’s 2009 strategic alliance with Fiat and its current and future prospects. Issues that are at the helm of this tie-up are technology sharing, global integration, quality control, and reorganization of brand portfolios. Students need to look at the intricacies of strategic alliances between two or more companies as well. As of May 2009, Chrysler is going through its Chapter 11 and corporate restructuring in the U. S. The company continues to shrink in terms of its manufacturing and global operations.Suggested Teaching Approach and Student Assignments Since the case is timely, it is recommended that class discussions should be based on the companies’ histories and their evolutionary growth (see Tables 2 and 3). Also important are topics such as strategic alliances, auto industry’s technology platforms, and brand portfolios. The questions included in the case for class discussion will require Web-based and library research on the part of students. It is recommended that the instructors provide a supplementary list of references on the auto industry (see: WardsAuto. om, JDPower. com, Automotive News, Google Search, Business Source Complete, Hoovers. com, Reuters. com, Value Line, Standard Poor’s Industry Surveys, etc. ). This will help students to be fully prepared for the case. Finally, students should be encouraged to visit Chrysler, Fiat, and other auto manufacturers’ Web sites before discussing this case in the classroom. Discussion Questions Answers Question 1. What are your views of the 2009 Chrysler-Fiat strategic alliance and its future prospects in the auto industry? Question 2. Analyze and evaluate Chrysler and Fiat’s strengths and weaknesses before and after their 2009 strategic alliance. Question 3. Compare and contrast Chrysler and Fiat with five other global auto manufacturers (GM, Ford, Toyota, Volkswagen and Daimler) in the areas of global operations and manufacturing issues. Question 4. Analyze Chrysler and Fiat’s brand portfolios in the world auto industry. How do you see both companies revamping and overhauling their brands in the short- (1-2 years) and long-terms (5-6 years). Question 5. What did you learn from the Chrysler-Fiat Strategic Alliance regarding managing multinationals in the changing global business? Case Analysis The Chrysler-Fiat strategic alliance will provide a meaningful opportunity to both companies regarding dealing with survival and expanding their markets in Europe and North America. As of 2009, it is evident that the companies are off to a good start. Both firms have marketable brands in their market segments but lack a collective effort. The case is a good example in the area of cross-border alliances that take place between two or more companies.Since 2008, Fiat has actively sought a partner in North America because of the attraction of the market. This is also attributed to the auto industry’s consolidation, restructuring, and cost-cutting activities. Chrysler and Fiat ended up seeking an alliance because of their compatibility, product portfolios, and markets. In Chrysler’s case, the main motive was to seek a partner who could help strengthen its financial problem regarding new technologies, markets, and quality standards.

Subsidies that intercollegiate athletic programs Assignment

Subsidies that intercollegiate athletic programs - Assignment Example In surprise, even the most successful programs receive huge amounts of money in the form of subsidies. A certain percentage of the student fees go to the general fund. Such central funds service subsidies to the Intercollegiate Athletic Programs (Killpatrick & Killpatrick, 2009). The small programs depend on student fees for their subsidies, instead of depending on the successful programs. This has led to a general increase in student fees in colleges that has raised concerns. Yes, athletics departments should be self-supporting. This is because they find access to well-paying television contracts. If there is proper management of the revenue, then the departments need to support themselves. In addition, they receive the ticket proceeds from large stadiums, where they collect the revenue from the sales. If the athletic departments develop a realistic budget, then they could easily have self-support. Some large athletic departments actually generate more revenue than they spend (Padilla & Boucher, 2007). This means that they do not need any additional money to fund their projects. Furthermore, if the athletic departments learn to be independent, then they are more likely to stabilize. This relates to the ability to remain financially stable even in times of economic slowdown. The worst concern is that even during an economic slowdown, some athletic departments do not lower their spending. This means that they have the capacity to become self-supporting and they need to become independent. The broadcasting rights have affected intercollegiate athletics in several ways. It has led to an increased generation of revenue. For instance, the NCAA generated over 80% of its revenue from the broadcasting contracts with TBS and CBS. Such income has led to the creation of a sustainable competitive advantage to intercollegiate athletics. Broadcasting rights are significant sources of

Project management Essay Example | Topics and Well Written Essays - 2000 words - 8

Project management - Essay Example We began working as a group and not individuals. The fourth stage was performing, where having known one another and chosen common goals, we began working on them. The final stage in this model is usually adjourning which is the splitting of the group so that individual members go separately, after the goals have been achieved. The second model we could use is the Gersick’s Punctuated Equilibrium Model which is a three-stage model as explained by Sharma (78). In its application, which did not apply in our case works by a group coming together almost naturally bound by a common framework. In its first phase, the members come together and establish a framework in which slow progress is observed. In the second phase called midpoint, the members discuss the framework and make decisions which assume they can lead to progress. In the last phase, action is taken according to the decisions made in stage two and the group experiences effects of the decisions they made. From these two models, the first one best describes how our group was developed. We came together and collected our ideas. After that we voted for the best ones and went about achieving them. After achieving our goals, the group was dissolved. In developing the group, we had nine factors that we observed as they could affect it and which â€Å"Organizational Development Portal† (n.p.) highlights. One of these was our goals and objectives which we had clearly set. These worked positively because we knew what to do. The second was utilizing our group resources which we controlled well, such that there were no complaints. The third factor was conflict resolution, which was a bit difficult to handle since all the members felt equal thus could not listen to each other. This was a negative factor. The fourth factor was leadership which we had constructed by voting using preferences and secret ballot. The leaders were respected because they were chosen by the members. This was positive. The fifth

Effects on septeber 11 2001 Essay Example | Topics and Well Written Essays - 500 words

Effects on septeber 11 2001 - Essay Example The modest effect was due to the Federal Reserve’s liquidity support to the financial community. One of the immediate effects of the attack though, is the downturn of the stock market. One lasting effect of the 9/11 tragedy is the increase in government funding in making production, distribution, finance and communication more secure in the US. More resources will be used for security rather than enhancing productive capacity (Makinen,7). In the aspect of world economies, additional security layers were placed in transporting goods which made it more costly in terms of distribution. There were greater impediments to the free movement of goods, services and capital (Makinen, 8). This also resulted in a slowdown in the growth of productivity. The effect of the terrorists’ attack was greatly felt in the tourism, airline and aviation and insurance industries. Even before 9/11, the airline industry was already experiencing financial troubles. The attack compounded the financial woes of several airline companies but the Federal government responded with an aid package (Makinen, 9). Air travel dropped tremendously as an aftermath of the attack; thus, there were several lay-offs in the industry. The insurance industry is one of the most affected industry by the 9/11 attack. â€Å"The loss of life and property gave rise to the largest property/casualty claim in history, estimated at US$40 billion† (Makinen, 9). Although the insurance companies were able to cover the claims, they became reluctant in providing coverage against future terrorists’ attack, not to mention that they do not have ample experience in deciding on the insurance rates and computing the reserves for it. Before the attack, the agriculture and food sector were already recovering from low prices and slow exports. Days after the attack there were some setbacks in the economy because of a stop in the commodities

Report 1 Essay Example | Topics and Well Written Essays - 1000 words

Report 1 - Essay Example The image of an organization can be negatively affected by a dress code that does not mirror seriousness. The Canadian Workplace All workers in Canada have a right to dress according to their tastes so long as their preferences do not collide with workplace stipulations (Krahn, Hughes, & Lowe, 2010). Sometimes, there are rules created by corporations about what is appropriate that infringe on the workers’ personal rights. For example, there are companies that do not approve of workers with tattoos, dreadlocks, beards, and facial rings. The rules of such corporations can be rendered irrelevant by court rulings, though this is not always what happens when the workers of such corporations sue them. Business owners and corporate directors in such cases are usually required to provide evidence that justifies the existence of such rules. Sometimes, employers provide valid reasons that result in courts upholding their rules on the appropriate dress codes. For example, manufacturing p lants that have a lot of machinery have a right to require that their workers remove all facial jewelry because it might get caught in the machines and seriously injure them. Since some employers are the creators of their own companies, they have a right to determine whether their workers should wear uniforms or dress in regular clothes. The only issue that employees can complain about are those to do with decency. For example, bar owners have no right to force their waiters and waitresses to dress in skimpy outfits that make them uncomfortable. If a worker sues his or her employer for being dismissed after refusing to wear skimpy clothes, a court can make the decision that the dismissal was unnecessary if it is established that the employer’s preferred dress code for workers was unreasonable. Moreover, there are sporadic cases where bar owners who have such dress codes have been allowed to dismiss workers who refuse to don skimpy outfits. In such cases, the bar owners proved in court that they had included information in previous work notices that informed potential workers about the type of work, as well as workplace uniform, that they would have to wear when working. In most cases where Canadian companies have dress codes that do not require that workers don indecent clothing, however, courts usually side with the employers. This is because the dress codes in such cases are usually enforced to prevent accidents in the workplace. For example, safety boots and gloves protect against accidents in the workplace. Employers have the right to implement dress codes when seeking to protect their workers so long as they explain their reasons for this to their employees. In some workplaces in Canada, workers are expected to dress in uniforms. Nurses, restaurant workers, and police officers are an example of workers who regularly don uniforms when at work. Their uniforms identify them to the public and enforce consistency in the labourforce. For nurses, their un iforms do not only identify them to the public, but also serve to protect their patients from catching any germs from the nurses who work with different patients all through the day. For restaurant workers, donning hair coverings is a way of stopping hair strands from falling into the food they serve to the customers.

Improving Corporate Governance in Saudi Arabia Essay

Improving Corporate Governance in Saudi Arabia - Essay Example The key theme in cooperate governance is the nature and the extent of accountability of individuals in the banking sector, and the tactics they use to suppress principal-agent problem2. Background Information Saudi Arabia is the 2nd largest state in the western Asia in relation to the area. It is also the second largest Arab world after Algeria3. The state has a large economy in reference to other nations in the region with a GDP of over US$450 billion. It has the capability to maintain its economy, with sustained economy4. Saudi’s banks are among the leading banks in the GCC banking sector. Their average annual return is between 14% and 31%. This is as a result of a favorable banking environment prevailing in the region. In the recent years, banks analysts in the regions propose the use of Basel II as it will impact the growth and development of the industry. However, the banking sector has different challenges regarding to governance and transparency. This calls for amendmen ts of the structure of banking governance of the banking sector as this will impact on the growth, and development of the banking industry5. Research question The proposal gives possible solution in Saudi’s banking system, as it has reluctant corporate banking principles. The sector is deteriorating, as a result of reluctance on the part of the law bodies, leading to neglect of some key principles in banking world. This is evident from the fact that board members are engaging in activities, which compromise their role. Shareholders have not been playing their roles because they have been taken up by the management. This calls for change to enhance growth in the sector. Research Objectives The proposal aims at giving suggestions, which will improve corporate banking in Saudi Arabia. This will impact the growth and development of the sector as it will attract investors both locally and internationally. The changes will motivate shareholder as they will trust the board members a nd the management at large. Methodology Corporate governance is an international issue; it calls for ideas from all areas of study. The proposal recommends the incorporation of both qualitative and qualitative research methodologies to enhance the reliability of the results. Detailed research is also significant. Empirical studies will also enhance in designing the most appropriate model of dealing with banking corporate governance in Saudi. Such research includes debates on the same issues in different nations, changes adopted by other nations, as well as, suggestions from bank analysts. Below are some of the areas targets, in the process of changing corporate banking governance. 1. Principles of banking corporate governance It is advisable for the banking sector to adopt the suggestion put forward in the Sarbanes-Oxley Act of 2002-2003 in USA, Cadbury Report of 1992 in UK, and the principles of Corporate Governance of 1998-2004 (OECD). 2. Corporate governance guidance in reference to Asian Policy Brief These are important guidelines put across to ensure that banking in Asia get to another level. It entails different suggestions which will impact on changing corporate governance in Saudi Arabia. 3. Banks’ board and management should perform their duty in relation to their fiduciary duty This entails the duty of care. The board together with the management should ensure that they respect that duty. They should be keen on ensuring

Apple Essay Example | Topics and Well Written Essays - 1750 words

Apple - Essay Example Apple leverages on its strong leadership and ability to beat stiff competition, in order to remain significant and overcome challenges such as the death of its co-founder Steve Jobs (Fowler & Vascellaro 1) and major ethical and managerial challenges. This analysis focuses on Apple’s unique culture and work environment, how the leadership style and organizational structure contribute to its growth, ethical challenges and how the company manages its internal and external conflicts. The paper asserts that Apple’s success is attributed to strong and efficient management of organization behavior and positive response to environmental challenges that offset the balance in organizational behavior. Apple has a unique culture driven by passion for new products with no end to challenges and opportunities. Apple is the pioneer of ‘work hard play hard’ ethic that advocates for maintenance of strong work ethics. However, although Apple’s work environment is often casual and relaxed, there is strong commitment to meeting deadlines. Thus, the work culture is fun yet demanding. Apple’s workers have great autonomy and independence of work as they work in a challenging and creative work environment. The company adopted a style that is neither too formal nor hierarchical and result-driven approach to work. The culture at Apple encourages creativity within the formal structure of product development and launches ((Fowler & Vascellaro 1). Apple is ‘an army’ everyone has a role in the product development cycle and is responsible for results in that role. The culture emphasizes on work ethics, workers’ autonomy and independence in their work. Th e culture also idolizes product development and a sense of continuous improvement. Apple has a unique work environment that focuses on organizational behavior. Human behavior at Apple is characterized by opportunities that give workers

Issue of importance, personal Essay Example | Topics and Well Written Essays - 500 words

Issue of importance, personal - Essay Example These organized crime groups try to legitimize their business as much as possible. These organized crime groups also bribe officials for their safety all over their vicinities (United States 2007; Finckenauer 2005). It was in the early twentieth century that organized crime started to emerge in United States. It is presumed that it was the Italian Mafia that entered the US in the very beginning. The immigrants who entered United States usually made their own ‘families’ and then fought with each other to cause problems for the civilians of the United States. It was then that the situation worsened and police officials entered the arena to wipe out the organized crime from United States. Organized crime in United States at first established themselves by pursuing illegal activities such as drug trafficking, prostitution, gambling and bootlegging. It was through these activities that organized crime established itself in the United States (Repetto 2004; US Congress 1968). Organized crime groups had their own methods and strategies to influence the government in such a way that the civilians did not even come to know. At the first instance the organized crime groups established legitimate businesses which would run as a cover for their illegal activities. Gambling and liquor trade gave them enough money to become millionaires from which they bribed the government officials who would then take sides of these crime groups. The government officials knew the power of these crime groups because of which they could not stand against them. The organized crime groups established power all over the states because of which they could influence the government in many ways (Repetto 2004; United States 2007). The post prohibition era is marked by the amendment in the constitution which legalized the liquor trade in United States. This came as blow to organized crime as many of them were dependent on

Service to Mankind Essay Example for Free

Service to Mankind Essay Not much over a hundred years ago, electricity, except in the form of lightning, was an unknown force. Its discovery was due to Michael Faraday, the great English scientist. On one occasion, about 1830, he was showing one of his early experiments to a distinguished company at the Royal Institution in London. He showed that when a magnet was brought suddenly near a coil of wire, a slight current of electricity was produced in the wire. Afterwards a lady said to him, But, Professor Faraday, even if the effect you explained is obtained, what is the use of it?† Madam, replied Faraday, will you tell me the use of a new-born child? The new-born child has grown to be a full-grown giant; for it is now one of the greatest natural forces that man has tamed to his own service. The ways in which men have learnt to use this great force are so many those only a few can be touched upon here. The first result of Faradays discovery was the electric telegraph, by which messages can be sent to a distance by means of an electric current sent along a conducting wire. Telegraphy means writing-at-a-distance. The first telegraph was installed in England, in 1835. Since then it has spread all over the world. Not long after, the submarine electric cable was laid under the Atlantic Ocean, connecting England with America. The next great invention was the electric telephone, first installed in England in 1876. The word telephone means speaking-at-a-distance; for by the telephone the human voice is carried to a distance by an electric current carried along a conducting wire. By its means we can talk to people, and hear them talking to us, hundreds of miles away. In our own time has come the wonderful invention of radio or wireless. Marconi found that messages could be sent by the electric waves in the ether, without any conducting wires. This led to broadcasting, by which we can hear music and speeches from countries hundreds and even thousands of miles away. Electric light came into use in the 19th Century, and it is the most used form of lighting today. Then electric power was applied as a motive force to machinery; and electric trams, electric trains, and electrically driven machinery came into use. Electricity is used also for heating houses, for cooking, for refrigerating, and in many other useful ways. If the nineteenth century was the age of steam, the period in which we are now living is the age of electricity.

Suicide Rates Statistics Analysis In India Sociology Essay

Suicide Rates Statistics Analysis In India Sociology Essay World Health Organization Assistant Director-General Catherine Le Gals-Camus finds that more people around the world die from suicide than other causes. 1. According to Dr Anuradha Bose, associate professor in pediatrics who also works for the CMCs department of community health, suicide is the third largest single cause of death among Indian youth between the ages of 15-19. One in every three cases of suicide in India is committed by people due to academic pressure. 2. A suicide is reported in India every 15 minutes and it is believed that there are many more cases of suicides that are not reported, so the actual number is very high. 3. Kerala, the state with the highest literacy rate in all of India also has the highest suicide rate which is an alarming factor for academic pressure. 4. The average suicide rate in India is 103 per 100,000 people compared with the worldwide average of 14.5 suicides per 100,000 people. 6. More than 100,000 people commit suicide in India every year and 3 people a day take their own lives in Mumbai. The rate of suicide among females in India is close to three times that of males. The average rate for suicide among males in India is 58 for every 100,000 and 148 for every 100,000 women. This is contradicting to the situation in other parts of the world where the rate of suicides is high among men rather than women. Females, in contrast to males, characteristically are more open to ask for medical help and to communicate their anxieties and fears to significant others. Males tend to be acutely aware of feelings of sexual inadequacy or inadequacy of masculinity and believe it shameful to communicate such feelings. This seems to hold true for college-age males and females as well as adolescents. POSSIBLE REASONS Although the reasons for suicide in students are likely as varied as the people who commit them, there are some primary reasons for the high suicide rate in India. Here are some of the most common reasons for committing suicide in India. 1. Pressure to perform: In this modern age, from the moment the child is born, hes brought up in a very competitive fashion. They are under tremendous pressure to deliver at schools well as sports and for competitive examinations. Parents and society expect a lot from the children and the pressure to perform is high. A lot of students contemplate suicide because they could not achieve the good scores expected by their parents. 2. Family conflict, including domestic violence: India is losing the support that has traditionally come from the joint family system, as many couples now opt to live on their own, away from the rest of the family. There is less bonding and interaction with the family members and the feeling of neglect make the children feel unwanted and they get depressed. 3. Ragging: In few cases, ragging in colleges has been found reason for suicide in their first year. The emotional and humiliating treatment that the seniors give the juniors, make them want to forget everything by ending their lives. 4. Copy-Cat: Another explanation for the high teenage suicide rate was copy-cat suicides where children read about suicides in newspapers and decide to do the same thing themselves. There have been many incidents where children try to imitate suicides scenes from movies for fun and end up getting killed 5. Virtual Lifestyle: These days children are hooked to videogames and computer. The internet can be considered as boon or bane. Children have been sucked into the virtual world and they have been so addicted to it that they find it hard to live in the real world. This has led to many suicides as they have not been able to become normal again The factors responsible behind the student suicide are quite different from other suicides like found in elders. The few trends have been observed in a survey in educational institutes across in US. Out of 2402 students, 1078 (45.8%) had psychological problems, half (1201 students) perceived problems in their role as students, 930 (45%) reported academic decline, 180 (8.82%) students reported that life was a burden, 122 (6%) reported suicidal ideas and 8 (0.39%) students reported suicidal attempt. There was significant correlation between students perception of life as a burden and class they were studying, mothers working status, psychological problems and problems students experienced in relation to study, peers, future planning and with parents. Risk Factors Biological Clues: Family history of mental illness including depression, puberty, cognitive impairments, disability, chronic illness, substance abuse, anxiety, mood disorders and conduct disorder Sociological: Contagion, peer pressure, family conflicts, drug and alcohol abuse, other abuse, academic pressures; expectations of school, family and self; break-up in a relationship, interpersonal losses, legal or disciplinary issues, bullying/harassment, negative social environment, victimization experiences Psychological: Negative self-talk like Im no good or I am not worthy; poor distress tolerance, poor resiliency, poor interpersonal problem-solving, black and white thinking, previous suicide attempt Existential: failure to see the good in the world, hopelessness: Whats the point its not going to change Communication The addressing of this social problem can be divided in two types- Proactive- Raising awareness among the students community at large at not to feel depressed and communicating that suicide is not an end to problems. Reactive This communication for those who need help right at the moment. As suicide tendency is very ephemeral  tendencies quite some time. If the patient can be counseled right at the moment than suicide can be avoided. I would propose an integrated communication plan across the channels as they have different reach and richness. Before going deeper we have to select the central communication idea for the campaign. As the basic problem is depression due to some failure , the value of life should be shown in all the campaign. The central idea can be Life is to live and not to end. You can end you life, not problems. The creative brief can be framed around what the chetan bhagat has mentioned in a address to students to a university- Dont be serious, be sincere. This quote has defined my work ever since. Whether its my writing, my job, my relationships or any of my goals. I get thousands of opinions on my writing every day. There is heaps of praise, there is intense criticism. If I take it all seriously, how will I write? Or rather, how will I live?  Life is not to be taken seriously, as we are really temporary here. We are like a pre-paid card with limited validity. If we are lucky, we may last another 50 years. And 50 years is just 2,500 weekends. Do we really need to get so worked up? Its ok, bunk a few classes, goof up a few interviews, fall in love. We are people, not programmed devices. Mass communication- This can be divided further in different execution ideas- Movies: Few movies and documentary can be made which showcases the people who sometimes were depressed and thought of doing suicide have fought against the problem and become successful. The recently released film 3 idiots portrays such a character in which a brilliant student commits suicide due to failure in the exams. Textbooks:- Last page of text books can be devoted to such na motivationall stories about the people who did not do well in studies but able to make the histories in their field. People like Sachin Tendulkar , Bill gates , Mark Zukerberg who are college drop outs can be cited to make sure that text book and exams are not the end in itself. Newspapers:- The stories of committing suicide should not be given prime importance as it may promote the copycat to further to take the path. Society should not sympathize with the people who commit suicide as it gives a signal to potential person to reach that destination. Counseling: Every college should have time to time personal interaction with their students and family members on their academic performance and behavioral changes if any. Research shows that timely personal counseling is the most successful factor in preventing suicide cases. If needed, a professional psychologist can be sought for effective counseling. The counseling should be extended to parents and teachers. They also have to be educated that not every child can be best at everything and they have to find out their childs interest. Recently released movie Taree Zameen Par showcases this that every child is good at something and we have to nurture their interest rather than imposing their will on the students. Some psychologist suggests that parents drives the things which they were not able to do during their times through their child an in this process they go beyond the capabilities of the child. The overall personality of a student should be other parameter like sports and art also in students morale boosting. Help Line- Various help line is set up across the world who help the person who are depressed and counseling. Few of the most popular one are as below- http://www.samaritansofboston.org/ You are not alone. http://www.befrienders.org/ A helpline in Mumbai, called Aasra, has been operating for several years to tackle the problem. Connect to Young kids- Face book page Fight Against Growing Teenage SUICIDES having 768 likes In January Samaritans hosts an annual memorial service open to all suicide survivors. Dr. Anuradha Bose has begun a program of family life education, which includes information on sex and relationship for high school students which he hopes will help, but he admits its a small start to a big problem. Maharastra, the Brihanmumbai Municipal Corporation (BMC) and the Bombay Psychiatry Society (BPS) have launched an intitiative Life is Beautiftul to locate syndromes of depression in child. They recently roped in Amir Khan as a Brand Ambassador fot hits. Campaign Motivation Parent Counseling Help line-

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

Extraversion :: essays research papers

Cross Cultural Evidence for the Fundamental Features of Extraversion   Ã‚  Ã‚  Ã‚  Ã‚  There has yet to be any determining evidence defines the characteristics of extraversion. The experimenters in this particular experiment have hypothesized that the facets of extraversion are somehow linked by reward sensitivity. This hypothesis was also tested against a model in which they are linked by sociability. There has been much work on this topic in the past, beginning with the works of Jung and James in the early 20th century—to the work of Watson and Clark in 1997. And even after a century of study, they are still unable to truly define the characteristics of the extraversion dimension of personality. In the many attempts to define extraversion, Watson and Clark have defined six basic facets of the personality trait. These are: venturesome, affiliation, positive affectivity, energy, ascendance, and ambition. Researchers Depue and Collins, in 1999, also offered a more succinct depiction of the characteristics of extraversion, this only having thre e basic parts. The first being affiliation, the enjoyment and value of close interpersonal bonds, also being warm and affectionate. The second, agency, being socially dominant, enjoying leadership roles, being assertive and exhibitionistic, and having a sense of potency in accomplishing goals. The final facet being impuslivity, but this one has been argued upon whether it should be included at all in the characteristics of extraversion at all.   Ã‚  Ã‚  Ã‚  Ã‚  Their first study was composed of 443 college students from two large universities in the Midwest. The participants were offered credit in their introductory psychology classes in return for their participation. They completed a questionnaire as part of their participation. 52% of the participants were men, and 48% were women. 94% were between the ages of 18 and 25. Only the 404 students that had complete data were used to set up the model that the experimenters formed. The second study tried to show any coincidence between the findings of American students and international ones.

Household Waste! :: essays research papers

Household Waste! One morning my mom said "Andy, get up and clean the bathroom!" It was always an essential and important labor to the family. I got up and gathered all the normal cleaning agents we used; Ajax, ammonia, and this liquid bleach that my mom said worked wonders. The toilet I cleaned using the Ajax the sink I cleaned using the Ajax there seemed to be no need for the other two. Then I saw it- the bath tub, AH! There was a ring around the bath tub that I knew would be difficult to clean off. I decided to add the ammonia I scrubbed at the ring but it was not coming off. I then looked around thinking what to do†¦ "The Bleach!" I shouted aloud. And then -- it hit me, my mom's hand. "Never, Never, Never, use Bleach with ammonia. Infact don't mix any chemicals with one another." This is an excellent example of common mistakes people make when dealing with household chemicals/cleaners. In this assignment I will examine different cleaners commonly used in my house. I Ajax I go to the cupboard and find a can of the powder, Ajax. The can use to have a piece of tape to cover the top but now it has been lost; a potential problem. The can has an expiration date on it, 9/98. This expiration date may be incorrect because that piece of tape to cover it has been lost for some time now. II Windex In the cupboard in the upstairs bathroom is where we keep the Windex. The Windex is blue and clearly labeled, with no chance of any person mistaking it for something else. The top part is tightly screwed on with Windex filled to  ¾ of the original volume. I cannot find any expiration date, nor can I find any hint there ever was one. I should contact the product vender to see if the Windex is immortal or what. III Vinegar I go to the kitchen cupboard and find vinegar. Vinegar is what we use to mop our tile floor with. The vinegar has an "Easy flip-off cap!" and is about half of what it originally was. This too, has no evidence of an expiration date. I don't think I need to contact the item vendor because it's only vinegar. IV Formula 409 Next to the Ajax in our "Cleaner-Cupboard" we carry Formula 409, the ideal for kitchen clean-up. It is clearly labeled with no chance for

Faulkner’s Forefathers in the Film, William Faulkner: A Life on Paper

The role of fathers looms large in this Faulkner documentary. In terms of strictly male lineage, William Faulkner seems trapped in this sort of grey world between being his own man and the fact that he was so much like his male ancestors. I imagine this is true of all individuals, struggling to make our way between ourselves as individuals and as shaped by our contexts. In Faulkner's case, however, he seems conspicuously geared towards adopting those traits first shown by his ancestors, the same arrogance, a "haughty pride,"and a tradition to "look for a fight." At the risk of psychoanalyzing far beyond my knowledge, what seemed interesting to me is how the collective Faulkner males seem content to rest on the laurels of their forefathers. Faulkner's father, for example, dreams of inheriting his father's fortune rather than making his own. Faulkner himself loafed through numerous jobs, perhaps only waiting for the colonel's writing abilities to be channeled through Faulkner's own ski lls and establish him as a writer. The dynamics of such behavior puzzle me. Is this some sort of inher...

Effective teachers Essay

The list of dispositions associated with effective teachers Once you are prepared, use the My Dispositions Target (Figure 2. 1) from your text to organize and record the initial analysis of your dispositions. This document should be placed as an attachment to your discussion response. To include the document as an attachment, locate the attachment feature in the bottom left-hand corner of the discussion response box. In your response: †¢Describe which of these dispositions (as well as those noted in Chapter 10) you already exhibit on a regular basis. When working with toddlers myself and my co-worker use several of these dispositions listed in Chapter 10. For instance †¢Based on the discussion of career options in Chapter 10, identify at least two possible careers that interest you and that are a â€Å"good fit† based on your personal disposition reflection. Explain why you would be a good fit for both of your chosen careers. †¢Discuss which dispositions are still emerging for you and how will you plan to develop them for both of your possible future career choices. Guided Response: Review several of your classmates’ posts and respond to at least two of your peers. In your responses, suggest some further ways your peers can develop their emerging dispositions. Estes, L. A. , & Krogh, S. (2012). Pathways to teaching young children: An introduction to early childhood education. San Diego, CA: Bridgepoint Education, Inc. Table 2. 1: Dispositions of effective teachers DispositionDescriptor ApproachableDemonstrates desire to interact through words and actions CommunicatorExpresses self clearly both verbally and in writing CompetentIs able to skillfully perform tasks related to teaching ConfidentIs self-assured and aware of personal abilities and strengths EnergeticMoves around frequently; participates fully in activities EnthusiasticDemonstrates passion for teaching, learning, and subject matter FunHas a sense of humor; smiles and laughs frequently InnovativeShows creativity when approaching tasks and solving problems InteractiveParticipates with others; talks with and listens to others KnowledgeableDemonstrates understanding of subject matter and teaching NurturingShows concern and caring to others; respects others OptimisticIs upbeat; has positive expectations for outcomes OrganizedPlans and prepares in advance; arranges things logically PatientShows tolerance for others; varies pace to accommodate others ProfessionalIs professional in dress, actions, and language; is polite Research has identified certain dispositions frequently associated with effective teachers. Personal Learning Insight 2. 1: My Dispositions Figure 2. 1: My dispositionstarget Individuals in the midst of becomingteachers should develop self-awareness oftheir own dispositions. After reading through the list of dispositions associated with effective teachers, pause a fewmoments to consider your own traits. Which of these dispositions are already evident in your demeanor? Do you believe these characteristics are part of who you are by virtue of birth or of experience? Are some dispositions still emerging, or needing to emerge? Because of the strong connection between dispositions and teaching styles, it is desirable forindividuals in the midst of becoming teachers to reflect and develop self-awareness of their owndispositions (Wadlington & Wadlington, 2011). As you complete this course and continue withother education courses, think about targeting some of the desirable dispositions as goals for yourongoing professional development. Use the My Dispositions Target (Figure 2. 1) to record yourinitial analysis of your dispositions. Many factors, other than desirable dispositions, are associated with learning how to successfully teach young children. The general public’sbelief that no specialized training is necessary to work with young children is simply a misconception. Research data has supported the positionthat teachers with specialized training and education in early childhood education is one of the more important factors in determining programquality for young children (NAECTE, 2008). Experts in the field of early childhood education rely on professional organizations for leadership indetermining what novice early childhood teachers should know (knowledge) and be able to do (skills).

Advertising Alcohol Essay

Alcohol has appeared in UK as well as around the world for many years. It plays a significant rule in the life of human. As British Medical Association in 2009, people in UK is the most of alcohol users in Europe. However, like other addictive substances, abuse of alcohol will bring a lot of bad consequences for people. Timms (2013) claimed that alcohol is the cause of psychosis, dementia, and physical problem. There are some people who claimed that government is not authorized to control the advertising of alcohol stricter than other products, but some were in the other idea that government should do it because of the bad impact from alcohol advertising to those who watch it, especially young people. This essay is aim to clarify the opinion that alcohol will result negative effect for human heath as well as social life and its advertising need to be restricted by government. Firstly, except useful of alcohol to people life, alcohol is cause of many negative problems. It is a fact that alcohol was used in to many industries such as food, heath service, and research also. Alcohol may good for heath with a limit amount. With reference from NIH (2003), in a great number of male surveyed, those who drank more than three times a week will have fewer heath risk than others who just drank less than once a week. However, according to Kenny (2012), people should not drink alcohol too much everyday. For instance, the limit of alcohol, which accepted by government, is 150–200ml for men and 100-150ml for women. Base on each habitus, drinking more than that unit may lead to sign of headache, dizzy, sickness, loss of control, etc. To reference from Hall’s research last year, 25% of deaths increase in the last ten years was caused by alcohol. It showed that most of people cannot control their drinking, and this number is increasing day by day. Thus, it is important to limit alcohol use. Secondly, alcoholics are threatening to the social life. It may be noted that drinking alcohol is dangerous not only for people but also their family. A lot of social evil and family violence are come from drunken people. When drinking too much wine or beer, the phenomenon of losing control will appear. Then, the drinker may have negative activities to people around. For example, according to Aquarius, 30% of sexual harassments were affected by alcohol. Furthermore, unfortunately, almost alcoholic was the cause of increasing unemployment (Macpherson, 1988). Then it tends to the thievery when alcoholics do not have money to buy alcohol. From those reasons, it is clear to see that alcohol is truly a hazard to people. Turning to the other side, advertising of alcohol will also bring the bad effect to people. Alcohol advertisement, like other product’s advertisement, is aim to approach people and persuade them to buy as much as possible. Actually, most of alcohol advertising content was received great evaluation from people under 23 years old (Jernigan, 2010). On the other hand, although people know the negative of using alcohol, promotion by any way will make them tend to use it naturally. Wilby (2008) claimed that people are strong affected by advertising of alcohol because they are easily to receive information provided by this advertisement. Advertising of alcohol makes people, especially the youth, image that it is the daily product. Moreover, Jernigan (2010) believed that almost alcohol companies tried to insert the combination of unmeasured features relative to cultural, religious and regulatory context on their advertising. Thus, they try using it everyday like the case that they saw on advertising. In British Medical Association (2009), researchers said â€Å"alcohol advertising and promotion increases the likelihood that adolescents will start to use alcohol and to drink more if they are already using alcohol†. Therefore, if alcohol companies are all free to do advertising by their own way, it will be dangerous for customer insight. Finally, alcohol advertising needs to be limited to protect customer from the wrong perception about wine or beer. In fact, alcohol companies have right to do advertise like other product in market. The more alcohol that they sold, the more money of tax government can earn. Follow HMRC (2013), alcohol products brought a huge number of revenue to UK, which is ? 3,323m from April to July 2013. This number illustrated for the great tax revenue that government earned from alcohol companies. However, the damage to people heath and life are bigger than that. Government had to pay more for the accident and medical insurance that come from effect of drinking too much alcohol. Therefore, limitation to the advertising content of alcohol is really necessary. In practice, government represents for the right of people, so they need to intervene to alcohol advertising for protecting customer. Although government cannot absolutely ban all the advertising of alcohol, they need to control it. For example, Hall (2012) believed that alcohol marketing â€Å"require that ads not link alcohol with sex, social success, youth culture or juvenile behavior†. In conclusion, the essay focused on difference points of whether alcohol advertising should be restricted or not, and the role of government in this situation. Obviously, whether drinking alcohol is good or not depends largely on the awareness of people who use it. Nevertheless, advertising this product widely on media will cause many bad impacts. For that reason, the strict guidelines and regulation for alcohol advertising is really needed. The government should strictly control this kind of product as well as develop propagandize for people about using alcohol in the right way. Apart from that, government also can impose more heavy taxes upon alcohol goods. This can force customer to use less alcohol and increase national income at the same time. References AQUARIUS (n. d. ) Alcohol and Violence [WWW] Aquarius. Available from: http://www. aquarius. org. uk/alcoholandviolence [Accessed 02/09/2013]. BRITISH MEDICAL ASSOCIATION (2009) Under the influence: the damaging effect of alcohol marketing on young people [WWW] Available from: http://www.alcohollearningcentre. org. uk/_library/undertheinfluence_tcm41-1900621. pdf [Accessed 24/08/13]. HALL, E. (2012) Sobering up the U. K. proves difficult. Advertising Age, 83 (17), pp. 9. HMRC (2013) Tax and Duty Bulletins [WWW] HM Revenue & Customs. Available from: https://www. uktradeinfo. com/Statistics/Pages/TaxAndDutybulletins. aspx [Accessed 01/09/2013]. JERNIGAN, D. (2010) The extent of global alcohol marketing and its impact on youth. Contemporary Drug Problems, 37 (1), pp. 57-89. MACPHERSON, N (1988) The Effect of Alcoholism on Earning Capacity [WWW] Economica. Available from: http://www. economica. ca/ew03_2p1. htm [Accessed 02/09/2013]. NIH (2003) Frequency of Light-to-Moderate Drinking Reduces Heart Disease Risk in Men [WWW] NIH. Available from: http://www. nih. gov/news/pr/jan2003/niaaa-08. htm [Accessed 31/08/2013]. Timms, P. (2013) Alcohol and depression [WWW] Royal College of Psychiatrists’ Public Education Editorial Board. Available from: http://www. rcpsych. ac. uk/mentalhealthinfoforall/problems/alcoholanddrugs/alcoholdepression. aspx [Accessed 31/08/2013]. WILBY, P. (2008) Under the influence. New Statesman, 137 (4887), pp. 17.

British Chinese Relations Essay

Following the transfer of Hong Kong from the British effectively ended many remnants of British imperialism in China, and in the process ended much of Britain’s involvement/power in Asia. The turnover has also given China control over one of the world’s leading financial institutions, thus improving not only its economic standing but also its ability to use soft power. The opposite could be said for the effects on the United Kingdom, where the turnover effectively halted their control over the economic powerhouse and ushered in a new era of Anglo-Chinese relations, yet this is not necessarily a bad thing. Since the turn over of Hong Kong from England, relations between China and the United Kingdom have improved and a larger bond has come about. Before I can begin to speak on the effects of â€Å"The Turnover,† I must first give a history of the events that made the turnover possible. Due to the trade imbalance between China and the United Kingdom in the 1800s, th e UK thought it might be advantageous to sell opium to the Chinese. Within a few years, the UK had gotten China addicted to opium and was starting to close the trade deficit. This in tern made the Qing dynasty officials very angry and they decided that they would disallow the importation of Opium into China. The British saw this act as an insult and in return they attacked China. This act started the first Opium War. Due to the Qing Dynasty’s limited armada, the British effectively wiped out the Qing forces and took possession of the land where Hong Kong currently is. The possession and occupation would not be â€Å"legally† binding until a treaty signed in 1898 that leased the land to the British for 99 years. Following the fall of the Qing dynasty and the rise of the Republic of China in 1912, the relationship between China and the United Kingdom still remained fairly unequal. At this time, the British Empire was still the world’s hegemonic leader and they were not afraid to show their might. This was reflected in the lending p ractices (or lack there off) that the British showed the Republic of China in those years. In these years following the foundation of the Republic, it was commonly known that the British would treat the Chinese as second class citizens in their own country while taking advantage of China’s resources. This was also evident in the effort that the British put into protecting its Chinese workers during World War 1 and World War 2. During the World Wars the UK failed to protect Hong Kong from the powers that attempted to invade it and in the process failed to prevent many preventable deaths. After World War 2, all Anglo-Chinese relations came to a complete halt. This is due to Chairman Mao deciding to close off all foreign interaction with the newly founded nation. This is due to what Mao thought was the influence of a corrupted political ideology and to help heal the wounds of British imperialism. Deng like Mao believed that a communist China was a good China, yet they disagreed as to what extent communism should have on the everyday lives of the people. While Mao’s main concern was providing the bare essentials to every Chinese citizen then China’s outlook on the world stage, Deng on the other hand wanted China to become a world power, then wanted to cater to the Chinese people, even going as far to state, â€Å"some will become rich faster than others.† It was in this mind frame that he started divvying up the collectively run state property to create competition between Chinese citizens. Deng felt this was necessary because the Chinese economy has been lagging since the start of the Great Leap Foreword and due to Mao’s policies; it looked as if it would continue on that track. During Mao’s communist campaign throughout China, many British feared that he might also have his eyes set on Hong Kong. Many British knew that their influence on the world stage was starting to weaken and that another costly war, with a country as large as a Soviet backed China, would prove disastrous to the British bottom line. Yet at the same time, many British were not fearful of China’s new communist regime because they thought it lacked the legitimacy and power to effectively resist the West’s hold on Hong Kong. During this time in history, the United Kingdom still possessed a large area of the world’s land and had a large navy that was capable of at least defending itself if it felt threatened enough. Also because the United Kingdom refused to acknowledge the PRC as a legitimate country, any provocation towards Hong Kong from Mao would have proved disastrous, as it might have set the stage for a foreign backed coup by the Nationalist forces. The British knew about these ways of thinking and at the time did not feel China, in its current state, was a legitimate threat to any of its resources or power that it had vested in Hong Kong or Macau. By the time Deng to the reigns in China, the United Kingdom was a shell of itself during the Imperialism era, and its relationship with China was no more that of a superior to inferior but more so on the level of equals. Analysts began to predict that because China had large numbers of cheap labor and a safely stable government, trade and manufacturing exports between Britain and China would prove advantageous to both nations. This is one of the reasons why the British began to see China as more of a player on the world stage. But even before Deng came to power in 1978, the UK still began to show some favor towards China by signing and even advocating UN Resolution 2758 which transfered the â€Å"China† Security Council seat from the Republic of China to the People’s Republic of China, respectfully. It was in these diplomatic agreements that China and the UK could find equal ground to later speak on the transfer of Hong Kong from British authority to Chinese authority. During the talks with the United Kingdom, China remained steadfast and strong on the issue of the UK retaining any authority over the region after the handover in the late 1990s. This is due to the fact that many of the Chinese leaders at that time thought that the treaties which gave the UK rights over the region were not done equatibly and some went as far as calling them downright illegal. Moreover, many at the time were surprised that the strong U.S. friend ally would even agree with talks with a Communist nation but at the time Britian had no choice. Hong Kong received the majority of its water and power from the PRC, let alone many of it’s exported items. These aspects combined with the fact of without the help of the United States, the United Kingdom had no way of effectively defending Hong Kong if t he the PRC decided to invade. For one of the first times since contact between the United Kingdom and China began, China had the complete upperhand against the British. Following the handover, relations between China and the U.K. have been relatively calm. Without out any vested insterest in the region, the United Kingdom does not come in contact with China very often because there isn’t much to speak about. Although many British companies do still own many factories in China, the factories are running smoothly and regulations on them have not become more or less strengent since the turnover, so there isn’t much for the British and Chinese to quarrel over. However, during these peaceful times, the United Kingdom’s economic and military might have remained reliatively stagnent while the China’s continues to grow, yet China does not recpricate the sentiment that Britian gave to it for so many years. If anything China has gone above and beyond with talks to England with China offering money to help out the European economy and agreeing to billions in trade to England. From my earlier interviews, I gathered that most people were happy that China has taken â€Å"the high road† in dealing with the United Kingdom. Most were pleased to see China becoming more active on the world stage, so they’d be upset if the Chinese government did anything to upset this activity, and causing trouble with the British would certainly upset this peace. For the majority of its history, China has prefered to use soft power to deal with its problems and one could surmise that it would do the same if it ever had any confrentations with England, but as of recently, China has not had to use its influence with the United Kingdom because talks have been cordial. One could suggust that these talks will remain the way for the forseeable future.

Physics Lab Report

Purpose Determine the acceleration in a quick sprint. Question What would the participant’s acceleration be if he/she sprints forward in a positive direction? Hypothesis/Prediction When a person sprints forward, it means he/she speeds up. Consequently, the acceleration should be positive. When the velocity accelerates at a constant rate, the acceleration should remain constant. Therefore, if the participant is moving toward a positive direction and the speed increases, then the acceleration should be positive and constant. Materials * Ticker Tape Machine * Ticker Tape * Tape * Ruler * Pencil * Graph paper Carbon paper Procedure * A piece of Ticker Tape and a Ticker Tape machine were taken. * Ticker Tape machine was plugged in. * One side of the Ticker Tape was attached to the back of a participant. * The other side of the Ticker Tape was inserted through the Ticker Tape machine. * A piece of carbon paper was placed on top of the Ticker Tape and was pinned on the machine. * The machine was started. * The participant sprinted forward. * The machine was stopped. * The used Ticker Tape was collected. * The machine was unplugged. * Using a ruler, a pencil and the Ticker Tape, all the data were recorded on a Data Table. Using the Data Table the position versus time graph and the velocity (instantaneous) versus time graph were plotted. Analysis There were in total of 37 dots recorded on the piece of the Ticker Tape. Every sixth dots represented the 1/60th of one second. Because of the lack of the information, as shown on the Data Table, every third dots were used to expand the amount of data for the more accurate results. Thus, every third dots were used to represent the half of 0. 1 second. Therefore, on both of the position versus time and velocity (instantaneous) versus time graphs, the x-axis value (the time value) went up by 0. 5 seconds. On the position versus time graph, a curved line was drawn due to the increase of the runner’s speed for each 0. 05 seconds. The runner started at 0 second from 0 centimeters and then stopped when the runner’s position was at 0. 65 seconds and 80. 1 centimeters. Also, the curved line on the graph continuously rose upward which meant that the runner never moved backward or slowed down. As evidenced by the velocity (instantaneous) versus time graph, the velocity was the lowest when it was 0 cm/s at 0 second and the highest when it reached positive196 cm/s at 0. 5 seconds. The difference of the velocities was the greatest between 0. 05 seconds and 0. 1 second. Also, the difference was the smallest between 0. 45 seconds and 0. 5 seconds. The two lines of best fit were used for more accuracy due to the scattered dots – which showed the calculated velocities of the specific time intervals – that were plotted on the graph. The first line was illustrated to show the readers the time interval of 0 second to 0. 275 seconds. The second line was used to show the time interval of 0. 2 75 seconds to 0. 65 seconds.Compared to the second line, the first line was drawn steeper due to the larger differences of the velocities of the specific time intervals. For the answer of this report’s question as listed above, when the runner sprinted forward toward a positive direction, the acceleration was able to be calculated from the velocity (instantaneous) versus time graph. In fact, there were two different accelerations during the whole time of 0. 65 seconds. Acceleration could be calculated by measuring the slopes of the velocity (instantaneous) versus time graph which were represented by the two lines of best fit.As shown on the graph, the first line was marked as and the second line was marked as . As seen on the Determination of the Acceleration page of this report, the following mathematical solutions were processed for the solution of the question. * Line * V2 = 134. 2 cm/s * V1 = 0 cm/s * t 2 = 0. 275 s * t 1 = 0 s * Acceleration = (134. 2 cm/s – 0 cm/ s) / (0. 275 s – 0 s) = 488 cm / s2 * Line * V2 = 196 cm/s * V1 = 134. 2 cm/s * t 2 = 0. 65 s * t1 = 0. 275 s * Acceleration = (196 cm/s – 134. 2 cm/s) / (0. 65 s – 0. 275 s) = 165 cm / s2With these two accelerations, it can be analyzed that the runner ran faster during the last 0. 375 seconds than he did during the first 0. 275 seconds. Evaluation This experiment examined the acceleration of a runner when sprinted toward a positive direction. Supported by the evidences and the results of this experiment, one of the two hypotheses stated above was proven false. The runner sped up in a positive direction in a straight line. Hypothetically, the velocity should have been accelerated at a constant rate so that the result could be a constant acceleration.However, according to the data collected, the runner’s first acceleration was 488 cm / s 2 from 0 second to 0. 275 seconds and the second one was 165 cm / s 2 from 0. 275 seconds to 0. 65 seconds. Since there were two different accelerations for 0. 65 seconds, there could not be a constant acceleration. Thus, the prediction of the acceleration being constant was falsified. On the other hand, the other part of the hypothesis was proven true. Theoretically, the acceleration of the runner should be positive because the runner sprinted in a positive direction.As evidenced by the two lines of best fit on the velocity (instantaneous) versus time graph, the slopes were positive due to their upward direction. Hence, since the slopes of the velocity versus time graph represented the person’s acceleration, the runner’s resulting accelerations were positives. To conclude, when the original hypotheses were compared to the calculated results, the first part – â€Å"there should be constant acceleration† – was rejected, on the contrary, the second part – â€Å"there should be a positive acceleration† – was accepted.There were several difficulties when this experiment was performed. For example, the Ticker Tape was so fragile that when the runner started to dart, the tape sometimes got ripped. Thus, it was a challenge to gather enough information to observe and analyze the results. Also, because of the rapid motion of the pin on the Ticker Tape machine, the carbon paper that was placed on top of the Ticker Tape continuously fell off from the machine. In addition, the loud noise produced from the machine created disturbing environment.To improve this lab, advanced technologies such as motion sensors could be used to keep the quiet atmosphere. Lastly, hand-drawn graphs and hand-measured values aren’t always correct. Consequently, they can lead the observers to the wrong conclusions. Therefore, using advanced graphing programs such as Graph 4. 4 could be used for more valid results. To summarize, to avoid miscalculations, advanced technologies and softwares must be used for more precise and accurate products.

Human Resource Strategy and Organizational Vision and Goals Essay - 2

Human Resource Strategy, Organizational Vision, Goals - Essay Example Since employees are the pillar of the organization, the role of human resource management becomes crucial in the employment of its workforce. In the emerging challenges of the changing business equations, when the labour deployment is undergoing quantitative and qualitative transformations, HR strategy needs to be redefined to create versatility and flexibility of the contemporary work environment. The rapid globalization and technological advancement of the recent time have greatly revolutionized the labour processes. With the advent of technology, the collective production has become more complex. There is a significant paradigm shift in the technical division of labour from direct to indirect model that is focused on regulation, administration, improvement and innovation to meet the challenges of the changing time. The human resource being central to the organizational visions and goals, HR leadership initiatives become a crucial factor for creating and organizing an effective workforce that is able to make the valuable contribution of promoting a sense of togetherness and collective responsibility that reflects in the increased output and improved performance outcome of the organizational goals and objectives. Julie Beardwell and Tim Claydon, in their book, have asserted that the theoretical concept of human resource management has become ‘fuzzy concept’ with abstract empiricism and needs to be looked from a wider perspective of providing the invaluable human capital that can meet the challenges of the rapid globalization and advancing technology. (Beardwell, Claydon, 2007). With the global competition becoming increasingly stiff, the specifications of the job are becoming less rigid and changing the overall perspective of job criteria and employment. The compulsions of the present times require versatility in the working force. Individuals and firms must embrace the culture of multi-skilled professionals that are able to meet the challenges with efficiency and unmatched proficiency.  Ã‚  

Children Whose Parents are Suffering from AIDS Essay

Children Whose Parents are Suffering from AIDS - Essay Example [International AIDS Society Communications Department (n.d)] AIDS is caused by a virus known as HIV, or Human Immunodeficiency Virus. When a human body is infected by HIV, it attacks upon the healthy cells of the body such as the white blood cells that function to keep us safe from different diseases. It thrives and multiplies in those cells weakening and damaging the white blood cells and ultimately, the human body as it loses its protection shield. [American Psychiatric Association (n.d)] The HIV virus can be transmitted when the HIV containing fluids of one person transfer to another person. Thus, HIV can be transferred through sex, by sharing needles, syringes (especially, while drug abuse as it is done with precaution) etc, and new born babies with infected mother can also get the virus. HIV virus, however, doesn't thrive in a medium outside of a human body so according to known researches, it is not possible to get infected through external mediums, such as air and water. It is also known that insects do not carry the virus. [American Psychiatric Association (n.d)] In our fast-paced world where cut-throat competition prevails, people... [American Psychiatric Association (n.d)] [International AIDS Society Communications Department (n.d)] MENTAL DISORDERS AND ITS EFFECT ON CHILDREN In our fast-paced world where cut-throat competition prevails, people have seen a rise in the occurrence of emotional stress, distress and depression. However, people inflicted with a deadly disease such as AIDS are more prone to suffer from such mental disorders. The feeling of helplessness and depression is also because of the fact that most of the societies in our world have not learnt to accept people with AIDS. Certainly, it is not easy for them. This has, anyhow, proved to be more negative for patients with AIDS as they are not only going to be fight with a fatal disease for the rest of their lives but are also being treated as outcasts and aliens by their fellowmen. Even more worse is the fact that sometimes the virus itself make attack the brain cells which may result in a loss of memory among other things. [American Psychiatric Association (n.d)] "Every day, about 14000 new HIV infections occur everyday" [International AIDS Society Communications Department (n.d)] Looking at the vast and dismal number of people that are likely to get diagnosed with AIDS is not comforting. As AIDS have been publicized as an incurable disease, it doesn't come as a shock to know that most of the patients start suffering from depression. Depression, in its own right is a very harmful mental disorder. Its symptoms include loss of interest in daily activities, loss of sleep, appetite and weight. Considering that HIV weakens the immune system, if a patient also suffers from depression, it is unlikely that he is going to get any better as lack of sleep, appetite and diversions are going to adversely affect the immune system

Enjoying the Hobby of Collecting Machineguns Essay

Enjoying the Hobby of Collecting Machineguns - Essay Example The machine gun has had a checkered history and was invented in the mid nineteenth century by Dr. Richard Jordon Gatling, whose weapon came to be known as the Gatling gun. He patented his invention in 1861. The Gatling gun was the first rapid firing gun and can be rightly called the ancestor of the modern machine gun. Dr Gatling said â€Å" it occurred to me that if I could invent a machine-a gun- which could by its rapidity of fire, enable , one man to do as much battle duty as a hundred, that it would to a large extent supersede the necessity of large armies and consequently , exposure to battle and disease would be greatly decreased.†2 People have been collecting guns all over the world for decades. It is akin to people collecting swords. But now a new hobby has emerged of collecting machine guns. In most countries in the world, owning a machine gun is illegal, but in the United States 34 states of the union, it is legal for citizens to own and shoot with machine guns. In case you wish to start a hobby as a machine gun collector than please insure that the state you reside allows you to own a machine gun as many states like Delaware, Hawaii, Iowa, Illinois, Kansas, New York, Rhode Island, South Carolina, Washington State and the district of Columbia, have a total ban on privately owned machine guns. However despite the above a quarter of a million Americans own machine guns. The National Firearms Act 1934 is the nodal act that governs collection of Machine Guns for any purpose or as a hobby. Before 1934, there was no bar on owning machine guns, but the NFA passed in 1934 made it mandatory to register the weapon with the Bureau of Alcohol, Tobacco and Fire arms (BATF)3.. Machine guns by and large have never been used in a crime as the procedure for owning a machine gun is very stringent. It must be noted that machine guns cannot be purchased across the counter and a lengthy period from 60to180

Software Testing Research Proposal Example | Topics and Well Written Essays - 1750 words

Software Testing - Research Proposal Example ording to David-at-el (1998), software testing is complicated and expensive and sometimes considered as a more time consuming part of overall system development life cycle. In this scenario the most of testing stages and activities are overlooked to deploy the system on time. Additionally, for cost saving and delivering system on due date system development team eliminates the system testing phase by minimizing few testing phases. However, sometime this action leads to problems in overall software working and handling for instance, the developed system has hidden bugs that appear during the system working and create problems for the system user(s). This type of problems leads toward the system failure or even working malfunction (Banks et al., 1998; Taipale & Smolander, 2006). 6 According to Mihnea & Constantinescu (2008), IT managers and professionals can have different opinions regarding a lot of software development principles, however the majority of them agree on one point that software we deliver has to be correct as well as reliable. In this scenario the successful software development groups have previously recognized that efficient testing is necessary to achieve this goal. In addition, researches have shown that most of software working and operational risks are due to some testing related problems (Mihnea & Constantinescu, 2008; Gelperin & Hetzel, 1988). In this scenario there is a vital need for the effective testing. My research is aimed at offering a group of testing techniques that will effectively manage and handle the software problems. The aim of this research is to offer a comprehensive and effective set of software testing techniques, types and execution framework. 7 Gallagher (2000) stated that testing is not quality assurance. It is examined that effectively tested software that was incompetently designed, poorly conceived as well as unconcernedly programmed will end up a well-tested, bad product. Though, software testing has long been one